how to print fasta file into jtable using netbeans IDE

Ads
 

how to print fasta file into jtable using netbeans IDE

mt file is :

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

now i want to print the lines "contig00001 length=586 numreads=4 "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea in netbeans IDE. when i click the any row in jtable,particular sequence should be displayed in jtextarea.please help me in this assignment. thanks.

View Answers

Ads









Related Tutorials/Questions & Answers:
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... in netbeans IDE. when i click the any row in jtable,particular sequence should... ctgaggactcctcg now i want to print the lines "contig00001 length=586 numreads=4
how to load flash file in any browser through jsp using NetBeans IDE without embed tag
how to load flash file in any browser through jsp using NetBeans IDE without embed tag  I am trying to load a flash file in broser from local disk using jsps.But it's not loading. I used tag like this <object id
Advertisements
How to Configure Tomcat Apache in Netbeans IDE
How to Configure Tomcat Apache in Netbeans IDE  Can any one tell me how to add tomcat server in Netbeans IDE? With its steps ?? Thnx
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest the logic to print such scenario thanks
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... area which is design below table in netbeans IDE. how to do that ? pls help me... want to displaythe above .txt file in jtable as following format having 3
To create an web application using netbeans IDE
To create an web application using netbeans IDE  Hi, I'm a beginner in java and I have created an jsp code for entering the username password... username and password details should enter in to oracle database.I want to know how
Java Programming using Netbeans - IDE Questions
Java Programming using Netbeans  Hello Dear sir, i got one scenario where i have to pick the data of the student like id , name , class , age & address using netbeans jframe then i have to store these data into my package so
how can i use ajax and jquery in netbeans ide
how can i use ajax and jquery in netbeans ide  i am using .net here we hav to download ajax controls and if i use netbeans ide and uses ajax control so from where i can get these controls.also i want to know which struct book i
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?  how to develop, compile & run a rmi program in netbeans 6.9.1 ide? will you please give me a step by step (practical) explaination? Thanks in advance
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java   Hi, i m interested to send the content of my jtextarea which i have developed in netbeans IDE to the webpage's textarea. how can i do
how to create a header in jtable using java swing
how to create a header in jtable using java swing  how to create a header in jtable using java swing   d
Create JSF Application Using NetBeans IDE
Create JSF Application Using NetBeans IDE  ... environment (IDE) written in the Java programming language. The NetBeans project... as an applicable framework to generate any type of application. The NetBeans 6.1 IDE
how can i run ASP.Net Server from netbeans IDE?
how can i run ASP.Net Server from netbeans IDE?  please help me how can i run ASP.Net Server from netbeans IDE? in other word , I have a web services... is wrote with netbeans Pleas I want a quick response
a complete project on spring web mvc using oracle database in netbeans ide 7.0
a complete project on spring web mvc using oracle database in netbeans ide 7.0  dear sir , i want a complete tutorial on the title matter.please sir help me . any full developped project based on shopping cart can
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components  I am beginner... swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
how to print all colors using awt
how to print all colors using awt  how to print all colors using awt
SQL STATEMENT in JDBC in NETBEANS IDE
SQL STATEMENT in JDBC in NETBEANS IDE  Iam using NETBEANS IDE. Iam developing a bank application. Using JDBC in SERVLETS For the withdraw function, "bal" and "ano" are user inputs when i wrote like, st.executeQuery("UPDATE
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help  import... { Hashtable ht=null; UploadFile file=null; try
How to zip a file using javascrip?
How to zip a file using javascrip?  hi.. can anyone tell me How to zip a file using javascrip
NetBeans IDE
NetBeans IDE         The NetBeans IDE, product of Sun Microsystems, is a free, open-source.... NetBeans IDE supports developers providing all the tools needed to create all
how to print HTML using javascript or Jquery
how to print HTML using javascript or Jquery  is there any way to print a document(created using Html and javascript) without using window.print... used Iframe for print, but this only work in chrome, but I have required one
How to write to file using FileWriter
How to write to file using FileWriter  hi, How to write to file using FileWriter thanks,   Hi, To writing in a file in Java program we... of the FileWriter class can be created using the following of its constructor i.e. FileWriter
How to write to file using FileOutputStream
How to write to file using FileOutputStream  Hi friends, Please help me in java program. How to write to file using FileOutputStream? thanks,   Hi, To write a file using FileOutputStream, we have to use
How to print the following output using c program
How to print the following output using c program  1) 4 3 4 2 3 4 1 2 3 4 2) A B C D E F G H I J
How to upload file using JSP?
How to upload file using JSP?   Hi all, I m the beginner in JSP, I want to upload file on server in specific folder.   1)page.jsp... file upload form to the user</TITLE></HEAD> <
how to create an excel file using java
how to create an excel file using java  how to create an excel file using java
How to open a file in java using JFileChooser
How to open a file in java using JFileChooser  How to open a file in java using JFileChooser
How to transfer a file in java using SSH & Telnet
How to transfer a file in java using SSH & Telnet  How to transfer a file in java using SSH & Telnet
jtable
jtable  hi Sir i am working netbeans IDE,I have a jtable when i insert values in jtable then i am unable to print all inserted values... 1,2,3,4,5,6,7,null. why it is not print 8 in place of "null" plz help me regards ravi

Ads