how to sort the text file and display it in jtable
my text file is:
contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg
i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans .
pls suggest the logic to print such scenario thanks.
View Answers
Ads
Related Tutorials/Questions & Answers:
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable my text file... ctgaggactcctcg i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to sort the text file and display it in jtable my text file... ctgaggactcctcg i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
Advertisements
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set...); } } Through the above code, you can insert the file data into JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set...); } } Through the above code, you can insert the file data into JTable
how to update the text file?
how to update the text file? my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...; } return quantity; }public void display() { System.out.println(item
how to update the text file? my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...; } return quantity; }public void display() { System.out.println(item
how to update the text file?
how to update the text file? if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
how to update the text file? if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
How to display a file for 24 hours?
How to display a file for 24 hours? How to display a file for 24 hours
How to display a file for 24 hours? How to display a file for 24 hours
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
how to convert image file to text file?
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
How to collect Java input field value display into Jtable?
How to collect Java input field value display into Jtable? <p>We would like to know how to collection input field data into Jtable...;text rate - input interest rate</li> <li>text Result - Display
How to collect Java input field value display into Jtable? <p>We would like to know how to collection input field data into Jtable...;text rate - input interest rate</li> <li>text Result - Display
how to display pdf file on browser
how to display pdf file on browser In my project i have created one pdf file(by pdfwriter) into my local mechine . after that it need to display in browser as a pdf file . but in jsp i can't display by iframe tag can anyone
how to display pdf file on browser In my project i have created one pdf file(by pdfwriter) into my local mechine . after that it need to display in browser as a pdf file . but in jsp i can't display by iframe tag can anyone
how to display webservice response in a text box
how to display webservice response in a text box Hallo, i have created a webservice and when i sended request to my webservice its sending proper response . the point is how to dispaly the response values in a text box usinj
how to display webservice response in a text box Hallo, i have created a webservice and when i sended request to my webservice its sending proper response . the point is how to dispaly the response values in a text box usinj
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How To Display MS Access Table into Swing JTable - Java Beginners
How To Display MS Access Table into Swing JTable How to Display Records From MS Access Database To JTable. Plz Help Me Hi Friend...){ System.out.println(e); } JTable table = new JTable(data, columnNames); TableColumn
How To Display MS Access Table into Swing JTable How to Display Records From MS Access Database To JTable. Plz Help Me Hi Friend...){ System.out.println(e); } JTable table = new JTable(data, columnNames); TableColumn
how to sort multiple key columns in CSV file - Java Beginners
how to sort multiple key columns in CSV file Hi Any one can assist how to sort the multiple key columns in CSV file? Any example will be appreciated. Thanks
how to sort multiple key columns in CSV file Hi Any one can assist how to sort the multiple key columns in CSV file? Any example will be appreciated. Thanks
How to append text to an existing file in Java
How to append text to an existing file in Java How to append text to an existing file in Java
How to append text to an existing file in Java How to append text to an existing file in Java
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
how to print fasta file into jtable using netbeans IDE mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
How to read text file in Servlets
How to read text file in Servlets This section illustrates you how to read text...). Then the writer.println(text) is used to display the content of the file Here
How to read text file in Servlets This section illustrates you how to read text...). Then the writer.println(text) is used to display the content of the file Here
how can i display a pdf file in a jtextarea
how can i display a pdf file in a jtextarea I need to display a pdf file in a jtextfield or in a jtextarea.Atlest i need to displat it in a jframe.I have a button and while clicking on it ,i need to choose the pdf file and need
how can i display a pdf file in a jtextarea I need to display a pdf file in a jtextfield or in a jtextarea.Atlest i need to displat it in a jframe.I have a button and while clicking on it ,i need to choose the pdf file and need
How to Display jrxml file on JSP page???
How to Display jrxml file on JSP page??? I made jrxml file using jasper report but how to display on jsp page?? i tried lot but still i didnt find out solution.so pls help me as soon as possible
How to Display jrxml file on JSP page??? I made jrxml file using jasper report but how to display on jsp page?? i tried lot but still i didnt find out solution.so pls help me as soon as possible
How to write file text In New Line
How to write file text In New Line Hi friends, How to write file text in new line in Java program. How to write the syntax for this with example... you went new text in new line. For this we created a new text file named
How to write file text In New Line Hi friends, How to write file text in new line in Java program. How to write the syntax for this with example... you went new text in new line. For this we created a new text file named
How to Convert Text Files into Gzip File
How to Convert Text Files into Gzip File Hi, I am developing a small application using PHP language. The real problem is that how do i convert the text files into gzip file. how can i solve the problem.... Tnanks
How to Convert Text Files into Gzip File Hi, I am developing a small application using PHP language. The real problem is that how do i convert the text files into gzip file. how can i solve the problem.... Tnanks
how to display image and text in single jsp page from the mysql database
how to display image and text in single jsp page from the mysql database hello please help me to display the image and text in single jsp page from mysql database if have any reference code please send me Thanks in advance
how to display image and text in single jsp page from the mysql database hello please help me to display the image and text in single jsp page from mysql database if have any reference code please send me Thanks in advance
Not able to display jtable at runtime
Not able to display jtable at runtime Hello, can anyone please help...[][] taskcells; JTable ttable; public void BuildTable() { Statement st; ResultSet rs...=new JTable(tasktable); TableColumnModel columnModel
Not able to display jtable at runtime Hello, can anyone please help...[][] taskcells; JTable ttable; public void BuildTable() { Statement st; ResultSet rs...=new JTable(tasktable); TableColumnModel columnModel
how to display data from jsp file into database
how to display data from jsp file into database this is a jsp file..." contentType="text/html; charset=UTF-8" pageEncoding="UTF-8"%> <%@page...="text" name="uname"></td></tr> <tr><td>First Name
how to display data from jsp file into database this is a jsp file..." contentType="text/html; charset=UTF-8" pageEncoding="UTF-8"%> <%@page...="text" name="uname"></td></tr> <tr><td>First Name
how to display the output of the newly created excel file
how to display the output of the newly created excel file the following program will create the test.xlsx file, how can i display the content of the test.xlsx file in the web browser? thanks, %@ page import
how to display the output of the newly created excel file the following program will create the test.xlsx file, how can i display the content of the test.xlsx file in the web browser? thanks, %@ page import
How to format text file? - Java Beginners
How to format text file? I want the answer for following Query ***(Java code) How to open,read and format text file(notepad) or MS-word... String getContents(File aFile) { StringBuilder contents = new StringBuilder
How to format text file? I want the answer for following Query ***(Java code) How to open,read and format text file(notepad) or MS-word... String getContents(File aFile) { StringBuilder contents = new StringBuilder
how to display the excel file content in the jsp
how to display the excel file content in the jsp How to present the content of the newly created excel file in the following jsp to the web browser: print("code sample"); <%@ page import="java.io.InputStream" %>
how to display the excel file content in the jsp How to present the content of the newly created excel file in the following jsp to the web browser: print("code sample"); <%@ page import="java.io.InputStream" %>
How To Display both image and data into Swing JTable which is retrieved from ms access database
How To Display both image and data into Swing JTable which is retrieved from ms access database So far this is my code how can i display both image and data from database.. while (rs.next()) { Vector row = new Vector(columns
How To Display both image and data into Swing JTable which is retrieved from ms access database So far this is my code how can i display both image and data from database.. while (rs.next()) { Vector row = new Vector(columns
Sort file data and write into another file
Sort file data and write into another file By sorting, you can arrange the data into meaningful order and analyze it more effectively. Here we have one file... and grade. The data is not properly arranged in the file. Now, we have to display
Sort file data and write into another file By sorting, you can arrange the data into meaningful order and analyze it more effectively. Here we have one file... and grade. The data is not properly arranged in the file. Now, we have to display
how to display the excel file in the web browser.
how to display the excel file in the web browser. > %@ page import="java.io.InputStream" > %> <%@ page > import="org.apache.poi.xssf.usermodel.XSSFSheet"%> > <%@ page > import
how to display the excel file in the web browser. > %@ page import="java.io.InputStream" > %> <%@ page > import="org.apache.poi.xssf.usermodel.XSSFSheet"%> > <%@ page > import
how to convert text file to xml file in java. - XML
how to convert text file to xml file in java. Hi all, I m having some problem. Problem is I want to convert a text file which is having the no of record(i.e no of different line of information)to a xml file through java
how to convert text file to xml file in java. Hi all, I m having some problem. Problem is I want to convert a text file which is having the no of record(i.e no of different line of information)to a xml file through java
