how to sort the text file and display it in jtable

how to sort the text file and display it in jtable

my text file is:

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans .

pls suggest the logic to print such scenario thanks.

View Answers

Ads









Related Tutorials/Questions & Answers:
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file... ctgaggactcctcg i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
Advertisements
How to display a file for 24 hours?
How to display a file for 24 hours?  How to display a file for 24 hours
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame.  import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How to collect Java input field value display into Jtable?
How to collect Java input field value display into Jtable?  <p>We would like to know how to collection input field data into Jtable...;text rate - input interest rate</li> <li>text Result - Display
how to display webservice response in a text box
how to display webservice response in a text box  Hallo, i have created a webservice and when i sended request to my webservice its sending proper response . the point is how to dispaly the response values in a text box usinj
how to convert image file to text file?
how to convert image file to text file?  hi, can anybody tell how to convert image file to text file? plz help me
Not able to display jtable at runtime
Not able to display jtable at runtime  Hello, can anyone please help...[][] taskcells; JTable ttable; public void BuildTable() { Statement st; ResultSet rs...=new JTable(tasktable); TableColumnModel columnModel
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
how can i display a pdf file in a jtextarea
how can i display a pdf file in a jtextarea  I need to display a pdf file in a jtextfield or in a jtextarea.Atlest i need to displat it in a jframe.I have a button and while clicking on it ,i need to choose the pdf file and need
How to Display jrxml file on JSP page???
How to Display jrxml file on JSP page???  I made jrxml file using jasper report but how to display on jsp page?? i tried lot but still i didnt find out solution.so pls help me as soon as possible
how to display data from jsp file into database
how to display data from jsp file into database  this is a jsp file..." contentType="text/html; charset=UTF-8" pageEncoding="UTF-8"%> <%@page...="text" name="uname"></td></tr> <tr><td>First Name
Display both image and data into Swing JTable
Display both image and data into Swing JTable  How To Display both image and data into Swing JTable which is retrieved from MySQL database
How to read text file in Servlets
How to read text file in Servlets       This section illustrates you how to read text...). Then the writer.println(text) is used to display the content of the file Here
how to display image and text in single jsp page from the mysql database
how to display image and text in single jsp page from the mysql database  hello please help me to display the image and text in single jsp page from mysql database if have any reference code please send me Thanks in advance
How to append text to an existing file in Java
How to append text to an existing file in Java  How to append text to an existing file in Java
How To Display both image and data into Swing JTable which is retrieved from ms access database
How To Display both image and data into Swing JTable which is retrieved from ms access database  So far this is my code how can i display both image and data from database.. while (rs.next()) { Vector row = new Vector(columns
how to display the output of the newly created excel file
how to display the output of the newly created excel file  the following program will create the test.xlsx file, how can i display the content of the test.xlsx file in the web browser? thanks, %@ page import
how to display the excel file content in the jsp
how to display the excel file content in the jsp  How to present the content of the newly created excel file in the following jsp to the web browser: print("code sample"); <%@ page import="java.io.InputStream" %>
how to display the excel file in the web browser.
how to display the excel file in the web browser.  > %@ page import="java.io.InputStream" > %> <%@ page > import="org.apache.poi.xssf.usermodel.XSSFSheet"%> > <%@ page > import
how to display csv file directly in IE browser .
how to display csv file directly in IE browser .  here is my code : public String download(){ if(log.isDebugEnabled()){ log.info... open directly in excel file but not in IE . I am using IE 8 with windows 7
How to write file text In New Line
How to write file text In New Line  Hi friends, How to write file text in new line in Java program. How to write the syntax for this with example... you went new text in new line. For this we created a new text file named
all sequences to create jdbc and how can i use jtable to display a single columns or multiple columns
all sequences to create jdbc and how can i use jtable to display a single... a view in my database schema so how can i create a jtable to look the view result... ); } } catch(Exception e){} JTable table = new JTable(data, columnNames); JScrollPane
How to Convert Text Files into Gzip File
How to Convert Text Files into Gzip File  Hi, I am developing a small application using PHP language. The real problem is that how do i convert the text files into gzip file. how can i solve the problem.... Tnanks
how to read a text file with scanner in java
how to read a text file with scanner in java  Hi, I am looking for the example code in Java for reading text file line by line using the Scanner class. how to read a text file with scanner in java? Thanks   Hi
How to add JTable in JPanel
How to add JTable in JPanel  How to add JTable in JPanel
how to display data from mysql table in text box using jsp??
how to display data from mysql table in text box using jsp??  <p>hi, i have a written a code to display data from a mysql table into txtboxes... at line: 113 in the jsp file: /Cat1.jsp The local variable v_RGPC may not have
Display non-duplicate words from file
Display non-duplicate words from file In this tutorial, you will learn how to read a text file and display non-duplicate words in ascending order. The given code reads the file and stored the file text into StringBuffer. The buffer
how to match the key word from a text file
how to match the key word from a text file  p>Hi all, I have the code to match the key word and from the text. I have input like this reader.txt... ((devstr = br.readLine()) != null) { String text = devstr; String text1
JTable
JTable   how to select a definite cell which containing a similar text containg to the one which the user entering from a jtable at runtime in java
CONVERT JTable DATA TO PDF FILE
CONVERT JTable DATA TO PDF FILE  HOW TO CONVERT JTable DATA TO .PDF FILE??PLEASE GIVE ME CODE FOR THAT.   Here is an example that reads the jtable data from the jframe and stored the data into the pdf file in the form

Ads