how to read text file in jtable in netbeans7.0
text file is:
contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg
i want to displaythe above .txt file in jtable as following format having 3 columns
contigID length size
and then display sequence like "ATGCGSA..." in text area which is design below table in netbeans IDE. how to do that ? pls help me thankx
View Answers
Ads
Related Tutorials/Questions & Answers:
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to sort the text file and display it in jtable my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
Advertisements
How to read text file to two different name array
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read a large text file line by line in java?
How to read a large text file line by line in java? I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
How to read a large text file line by line in java? I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
Steps to read text file in pyspark
Steps to read text file in pyspark Hi, I am learning to write program in PySpark. I want to simply read a text file in Pyspark and then try some code. What are the Steps to read text file in pyspark? How much time it takes
Steps to read text file in pyspark Hi, I am learning to write program in PySpark. I want to simply read a text file in Pyspark and then try some code. What are the Steps to read text file in pyspark? How much time it takes
Remove JTable row that read txt file records
Remove JTable row that read txt file records Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
Remove JTable row that read txt file records Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
how to write and read text for javaME
how to write and read text for javaME Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
how to write and read text for javaME Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
Read Lines from text file
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
How to read file in java
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
Read text file in PySpark
Read text file in PySpark - How to read a text file in PySpark? The PySpark... configuration conf = SparkConf().setAppName("read text file in pyspark") sc... context with Spark configuration conf = SparkConf().setAppName("read text file
Read text file in PySpark - How to read a text file in PySpark? The PySpark... configuration conf = SparkConf().setAppName("read text file in pyspark") sc... context with Spark configuration conf = SparkConf().setAppName("read text file
Java read text file
. Here is the video insturction "How to read text file in Java?"...In the section we are discussing about how to read file line by line. Here we... a text file one line at a time. It can also be used to read large text files
. Here is the video insturction "How to read text file in Java?"...In the section we are discussing about how to read file line by line. Here we... a text file one line at a time. It can also be used to read large text files
How to read and retrieve jtable row values into jtextfield on clicking at particular row ...
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
How to Read a File in Java
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
Java program to read a text file and write to another file
Java program to read a text file and write to another file - Creating.... Our requirement is to read a text file and then write the content of the text... and the class is used to read data from a file. The could be text file
Java program to read a text file and write to another file - Creating.... Our requirement is to read a text file and then write the content of the text... and the class is used to read data from a file. The could be text file
How to read the .doc/ .docx file in Java Program
How to read the .doc/ .docx file in Java Program Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
How to read the .doc/ .docx file in Java Program Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
How To Read File In Java with BufferedReader
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... java.io.*; /** * How To Read File In Java with BufferedReader class
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... java.io.*; /** * How To Read File In Java with BufferedReader class
how to convert image file to text file?
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How to Read a file line by line using BufferedReader?
How to Read a file line by line using BufferedReader? Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
How to Read a file line by line using BufferedReader? Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
Read specific column data from text file in java
Read specific column data from text file in java My question is if my text file contain 15 columns and i want read specific column data from that text file then what code i should do
Read specific column data from text file in java My question is if my text file contain 15 columns and i want read specific column data from that text file then what code i should do
how to read and write an xml file using java
how to read and write an xml file using java Hi Can anyone help me how to read and write an xml file which has CData using java
how to read and write an xml file using java Hi Can anyone help me how to read and write an xml file which has CData using java
How To Read File In Java
How To Read File In Java In this section we will discuss about about how data of a file can be read in Java. A file can contain data as bytes, characters.... Example This example demonstrates that how to read a file in java. To read a file
How To Read File In Java In this section we will discuss about about how data of a file can be read in Java. A file can contain data as bytes, characters.... Example This example demonstrates that how to read a file in java. To read a file
How to read big file line by line in java?
Learn how to write a program in java for reading big text file line by line In this tutorial I will explain you how you can read big file line by line... to read the big file in your java program. For example you have to process some
Learn how to write a program in java for reading big text file line by line In this tutorial I will explain you how you can read big file line by line... to read the big file in your java program. For example you have to process some
write a program in java to read a text file and write the output to an excel file using filereader and filewriter?
write a program in java to read a text file and write the output to an excel file using filereader and filewriter? write a program in java to read a text file and write the output to an excel file using filereader and filewriter
write a program in java to read a text file and write the output to an excel file using filereader and filewriter? write a program in java to read a text file and write the output to an excel file using filereader and filewriter
How to read properties file in Java?
to value. The java.util.Properties class is used to read the properties file. The properties files are simple text file which is saved as .properties...() method of the Properties class is used to read the value of the properties file
to value. The java.util.Properties class is used to read the properties file. The properties files are simple text file which is saved as .properties...() method of the Properties class is used to read the value of the properties file
How to append text to an existing file in Java
How to append text to an existing file in Java How to append text to an existing file in Java
How to append text to an existing file in Java How to append text to an existing file in Java
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
how to print fasta file into jtable using netbeans IDE mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
How to read properties file in java
How to read properties file in java Description of Example:- In this example... of: "How to read properties file in Java?" How we will create... read properties file;- ResourceBundle. Properties Class.
How to read properties file in java Description of Example:- In this example... of: "How to read properties file in Java?" How we will create... read properties file;- ResourceBundle. Properties Class.
How to read the contents in a file which is of input type file
How to read the contents in a file which is of input type file I have a jsp page wherein i have to passs the file as input and read the contentsn... //In this servlet page i have tried to read the contents of a file in doPost method. I have used
How to read the contents in a file which is of input type file I have a jsp page wherein i have to passs the file as input and read the contentsn... //In this servlet page i have tried to read the contents of a file in doPost method. I have used
