how to read text file in jtable in netbeans7.0
text file is:
contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg
i want to displaythe above .txt file in jtable as following format having 3 columns
contigID length size
and then display sequence like "ATGCGSA..." in text area which is design below table in netbeans IDE. how to do that ? pls help me thankx
View Answers
Ads
Related Tutorials/Questions & Answers:
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to sort the text file and display it in jtable my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
Advertisements
How to read text file in Servlets
How to read text file in Servlets This section illustrates you how to read text file in servlets. In this example we will use the input stream to read the text
How to read text file in Servlets This section illustrates you how to read text file in servlets. In this example we will use the input stream to read the text
How to read text file to two different name array
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read the data in text file seperated by by ',' in java using IO Operations
How to read the data in text file seperated by by ',' in java using IO Operations in Text file data like raju 45,56,67 ramu 46,65,78 raji 34,23,56 this is the student marks in text file.this data read and calculate
How to read the data in text file seperated by by ',' in java using IO Operations in Text file data like raju 45,56,67 ramu 46,65,78 raji 34,23,56 this is the student marks in text file.this data read and calculate
How to read a large text file line by line in java?
How to read a large text file line by line in java? I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
How to read a large text file line by line in java? I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
Read Lines from text file
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
how to write and read text for javaME
how to write and read text for javaME Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
how to write and read text for javaME Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
Remove JTable row that read txt file records
Remove JTable row that read txt file records Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
Remove JTable row that read txt file records Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
How to read and compare content of two different text file
Description: In the given example you will see how a two text file's content are compared. The BufferedReader class allow us to read a file. The readLine() method used to read the contents of the specified file. The way
Description: In the given example you will see how a two text file's content are compared. The BufferedReader class allow us to read a file. The readLine() method used to read the contents of the specified file. The way
Read Text file from Javascript - JSP-Servlet
Read Text file from Javascript plz send the code How to Retrieve the data from .txt file thru Javascript? And how to find the perticular words in that file
Read Text file from Javascript plz send the code How to Retrieve the data from .txt file thru Javascript? And how to find the perticular words in that file
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set... with AbstractTableModel to inherit its methods and properties. Now we have read the file
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set... with AbstractTableModel to inherit its methods and properties. Now we have read the file
How to read file in java
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
Java read text file
. Here is the video insturction "How to read text file in Java?"...In the section we are discussing about how to read file line by line. Here we... a text file one line at a time. It can also be used to read large text files
. Here is the video insturction "How to read text file in Java?"...In the section we are discussing about how to read file line by line. Here we... a text file one line at a time. It can also be used to read large text files
read text file and store the data in mysql - JDBC
read text file and store the data in mysql when we store the data in mysql table from text file its store the data from new line to new column. how to store the data in different column from a single line of text file.
read text file and store the data in mysql when we store the data in mysql table from text file its store the data from new line to new column. how to store the data in different column from a single line of text file.
how to read this xml file - XML
how to read this xml file i want to read this xml file using java... read i have tried lot more , but i am not able to read this xml file... name=client menu=client action=read user employee add
how to read this xml file i want to read this xml file using java... read i have tried lot more , but i am not able to read this xml file... name=client menu=client action=read user employee add
how to update the text file?
how to update the text file? if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
how to update the text file? if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
How to read and retrieve jtable row values into jtextfield on clicking at particular row ...
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
how to update the text file?
how to update the text file? my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...]; for(int i=0;i File file ; FileReader fr=null ; FileWriter
how to update the text file? my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...]; for(int i=0;i File file ; FileReader fr=null ; FileWriter
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How to Read a File in Java
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
How to read text from - Java Beginners
How to read text from How to retrieve text from the images... Does we have any function to get text over the images Hi Friend, We are providing you a code that will set text over an image using javascript
How to read text from How to retrieve text from the images... Does we have any function to get text over the images Hi Friend, We are providing you a code that will set text over an image using javascript
how to convert image file to text file?
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me
How to read the .doc/ .docx file in Java Program
How to read the .doc/ .docx file in Java Program Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
How to read the .doc/ .docx file in Java Program Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
How To Read File In Java with BufferedReader
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... java.io.*; /** * How To Read File In Java with BufferedReader class
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... java.io.*; /** * How To Read File In Java with BufferedReader class
Read specific column data from text file in java
Read specific column data from text file in java My question is if my text file contain 15 columns and i want read specific column data from that text file then what code i should do
Read specific column data from text file in java My question is if my text file contain 15 columns and i want read specific column data from that text file then what code i should do
How to Read a file line by line using BufferedReader?
How to Read a file line by line using BufferedReader? Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
How to Read a file line by line using BufferedReader? Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
how to read and write an xml file using java
how to read and write an xml file using java Hi Can anyone help me how to read and write an xml file which has CData using java
how to read and write an xml file using java Hi Can anyone help me how to read and write an xml file which has CData using java
