Latest Tutorials| Questions and Answers|Ask Questions?|Site Map



Home Answers Viewqa Java-Beginners how to print fasta file into jtable using netbeans IDE
Login         

View Questions and Answers by Category

Advertisements


 
Have Programming Question? Ask it here!
 
 
 


Raghav Purankar
how to print fasta file into jtable using netbeans IDE
0 Answer(s)      3 years and 4 months ago
Posted in : Java Beginners


mt file is :

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

now i want to print the lines "contig00001 length=586 numreads=4 "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea in netbeans IDE. when i click the any row in jtable,particular sequence should be displayed in jtextarea.please help me in this assignment. thanks.


Advertisement
View Answers

Related Tutorials/Questions & Answers:
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... in netbeans IDE. when i click the any row in jtable,particular sequence should... ctgaggactcctcg now i want to print the lines "contig00001 length=586 numreads=4
how to load flash file in any browser through jsp using NetBeans IDE without embed tag
how to load flash file in any browser through jsp using NetBeans IDE without embed tag  I am trying to load a flash file in broser from local disk using jsps.But it's not loading. I used tag like this <object id
Advertisements
how to launch a web application using java web start in netbeans ide?
how to launch a web application using java web start in netbeans ide?  Hi RoseIndia, I need to launch my web application(web pages-jsp) using java web start in Netbeans IDE, Please can anyone help me how to do this...I knw
How to Configure Tomcat Apache in Netbeans IDE
How to Configure Tomcat Apache in Netbeans IDE  Can any one tell me how to add tomcat server in Netbeans IDE? With its steps ?? Thnx
To create an web application using netbeans IDE
To create an web application using netbeans IDE  Hi, I'm a beginner in java and I have created an jsp code for entering the username password... username and password details should enter in to oracle database.I want to know how
Java Programming using Netbeans - IDE Questions
Java Programming using Netbeans  Hello Dear sir, i got one scenario where i have to pick the data of the student like id , name , class , age & address using netbeans jframe then i have to store these data into my package so
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest the logic to print such scenario thanks
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... area which is design below table in netbeans IDE. how to do that ? pls help me... want to displaythe above .txt file in jtable as following format having 3
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java   Hi, i m interested to send the content of my jtextarea which i have developed in netbeans IDE to the webpage's textarea. how can i do
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?  how to develop, compile & run a rmi program in netbeans 6.9.1 ide? will you please give me a step by step (practical) explaination? Thanks in advance
how can i use ajax and jquery in netbeans ide
how can i use ajax and jquery in netbeans ide  i am using .net here we hav to download ajax controls and if i use netbeans ide and uses ajax control so from where i can get these controls.also i want to know which struct book i
how can i run ASP.Net Server from netbeans IDE?
how can i run ASP.Net Server from netbeans IDE?  please help me how can i run ASP.Net Server from netbeans IDE? in other word , I have a web services... is wrote with netbeans Pleas I want a quick response
Create JSF Application Using NetBeans IDE
Create JSF Application Using NetBeans IDE  ... environment (IDE) written in the Java programming language. The NetBeans project... as an applicable framework to generate any type of application. The NetBeans 6.1 IDE
how to create a header in jtable using java swing
how to create a header in jtable using java swing  how to create a header in jtable using java swing   d
netbeans resource prob - IDE Questions
netbeans resource prob  Hi,please can you tell me how to include a file like an image in the jar package in netbeans so that i dont need to provide... i the jar package I am using netbeans version 6.7.1
NetBeans - IDE Questions
NetBeans  Can we use netbeans to create servlet, jsp pages?If yes means can you explain how it can be done? how to use netbeans for creating jsp...://www.roseindia.net/jsf/netbeans/create-jsf-application.shtml Hope that it will be helpful
How to open a .war file inside Netbean IDE? - IDE Questions
How to open a .war file inside Netbean IDE?  Dear experts, I've been trying to read a .war file inside my Netbean IDE alot of times... netbean as .war file. When I pressed the run tab inside my netbean ide to see how
a complete project on spring web mvc using oracle database in netbeans ide 7.0
a complete project on spring web mvc using oracle database in netbeans ide 7.0  dear sir , i want a complete tutorial on the title matter.please sir help me . any full developped project based on shopping cart can
NetBeans IDE
NetBeans IDE         The NetBeans IDE, product of Sun Microsystems, is a free, open-source.... NetBeans IDE supports developers providing all the tools needed to create all
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components  I am beginner... swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
SQL STATEMENT in JDBC in NETBEANS IDE
SQL STATEMENT in JDBC in NETBEANS IDE  Iam using NETBEANS IDE. Iam developing a bank application. Using JDBC in SERVLETS For the withdraw function, "bal" and "ano" are user inputs when i wrote like, st.executeQuery("UPDATE
how to print all colors using awt
how to print all colors using awt  how to print all colors using awt
netbeans - IDE Questions
netbeans  I am uploading pdf file to tomcat server and i am using net beans. I am saving my file in /web/PDF/ directory. and my prob is when i am viewing my file I can not get it back by using http://localhost:8084/PDF
How to launch my web application from my desktop without opening Netbeans IDE everytime i run the application?
How to launch my web application from my desktop without opening Netbeans IDE... to open Netbeans IDE then need to start Glassfish server,then type the url, so i... for my previous question but i knw how to create JSP pages, I have completed my
Web Services Examples in NetBeans
; In this section we will develop webservices using NetBeans IDE. NetBeans IDE is one... program I will show you how you can make webservices in the Netbeans IDE. NetBeans... and test the webservices very easily in the NetBeans IDE. NetBeans
how to print HTML using javascript or Jquery
how to print HTML using javascript or Jquery  is there any way to print a document(created using Html and javascript) without using window.print... used Iframe for print, but this only work in chrome, but I have required one
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help  import... { Hashtable ht=null; UploadFile file=null; try
netbeans coding prob - IDE Questions
() etc how should i do it? both classes are in the same package. PLEASE TELL ME HOW TO DO IT IN NETBEANS. THANK YOU  Hi Friend, Please visit...netbeans coding prob  hi, i have just started programming in netbeans
How to print the following output using c program
How to print the following output using c program  1) 4 3 4 2 3 4 1 2 3 4 2) A B C D E F G H I J
 

 

 

DMCA.com