how to print fasta file into jtable using netbeans IDE

Home Answers Viewqa Java-Beginners how to print fasta file into jtable using netbeans IDE

Raghav Purankar

how to print fasta file into jtable using netbeans IDE
0 Answer(s) 2 years ago
Posted in : Java Beginners

mt file is :

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

now i want to print the lines "contig00001 length=586 numreads=4 "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea in netbeans IDE. when i click the any row in jtable,particular sequence should be displayed in jtextarea.please help me in this assignment. thanks.

View Answers

how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE mt file... in netbeans IDE. when i click the any row in jtable,particular sequence should... ctgaggactcctcg now i want to print the lines "contig00001 length=586 numreads=4

netbeans resource prob - IDE Questions
netbeans resource prob Hi,please can you tell me how to include a file like an image in the jar package in netbeans so that i dont need to provide... i the jar package I am using netbeans version 6.7.1

NetBeans IDE
Java NotesNetBeans IDE Sections: Introduction to NetBeans Downloading... 4.1)] NetBeans is a free, open-source, IDE which is available.... Start with that the NetBeans IDE 5.0 Quick Start Guide

jtable
jtable hi Sir i am working netbeans IDE,I have a jtable when i insert values in jtable then i am unable to print all inserted values... 1,2,3,4,5,6,7,null. why it is not print 8 in place of "null" plz help me regards ravi

Create JSF Application Using NetBeans IDE
Create JSF Application Using NetBeans IDE ... environment (IDE) written in the Java programming language. The NetBeans project... as an applicable framework to generate any type of application. The NetBeans 6.1 IDE

how to load flash file in any browser through jsp using NetBeans IDE without embed tag
how to load flash file in any browser through jsp using NetBeans IDE without embed tag I am trying to load a flash file in broser from local disk using jsps.But it's not loading. I used tag like this <object id

netbeans - IDE Questions
netbeans I am uploading pdf file to tomcat server and i am using net beans. I am saving my file in /web/PDF/ directory. and my prob is when i am viewing my file I can not get it back by using http://localhost:8084/PDF

NetBeans JSF Tutorial
in NetBeans IDE. This example illustrates how to print hello world in JSF application using NetBeans IDE. Creating... Application Using NetBeans IDE The NetBeans IDE is a flexible arrangement

how to sort the text file and display it in jtable
how to sort the text file and display it in jtable my text file... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest the logic to print such scenario thanks

how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0 text file... area which is design below table in netbeans IDE. how to do that ? pls help me... want to displaythe above .txt file in jtable as following format having 3

Web Services Examples in NetBeans
; In this section we will develop webservices using NetBeans IDE. NetBeans IDE is one... program I will show you how you can make webservices in the Netbeans IDE. NetBeans... and test the webservices very easily in the NetBeans IDE. NetBeans

how to launch a web application using java web start in netbeans ide?
how to launch a web application using java web start in netbeans ide? Hi RoseIndia, I need to launch my web application(web pages-jsp) using java web start in Netbeans IDE, Please can anyone help me how to do this...I knw

To create an web application using netbeans IDE
To create an web application using netbeans IDE Hi, I'm a beginner in java and I have created an jsp code for entering the username password... username and password details should enter in to oracle database.I want to know how

NetBeans
NetBeans Hi, I am Kundan I have made a project on NetBeans. And now I want to know that how can i run my project without NetBeans IDE,on other PC. Please help me it's important

how can i use ajax and jquery in netbeans ide
how can i use ajax and jquery in netbeans ide i am using .net here we hav to download ajax controls and if i use netbeans ide and uses ajax control so from where i can get these controls.also i want to know which struct book i

NetBeans - IDE Questions
NetBeans Can we use netbeans to create servlet, jsp pages?If yes means can you explain how it can be done? how to use netbeans for creating jsp...://www.roseindia.net/jsf/netbeans/create-jsf-application.shtml Hope that it will be helpful

How to Configure Tomcat Apache in Netbeans IDE
How to Configure Tomcat Apache in Netbeans IDE Can any one tell me how to add tomcat server in Netbeans IDE? With its steps ?? Thnx

java swings - IDE Questions
java swings I'm developing a java desktop database application using NetBeans 6.5 and using mysql as database,When I create the table and link... of that front end,if yes how? please answer me Hi Friend, Please

SQL STATEMENT in JDBC in NETBEANS IDE
SQL STATEMENT in JDBC in NETBEANS IDE Iam using NETBEANS IDE. Iam developing a bank application. Using JDBC in SERVLETS For the withdraw function, "bal" and "ano" are user inputs when i wrote like, st.executeQuery("UPDATE

javaa swings - IDE Questions
javaa swings I'm developing a java desktop database application using NetBeans 6.5 and using mysql as database,When I create the table and link... of that front end,if yes how? Jtable look n feel should be changed please

netbeans coding prob - IDE Questions
() etc how should i do it? both classes are in the same package. PLEASE TELL ME HOW TO DO IT IN NETBEANS. THANK YOU Hi Friend, Please visit...netbeans coding prob hi, i have just started programming in netbeans

Java Programming using Netbeans - IDE Questions
Java Programming using Netbeans Hello Dear sir, i got one scenario where i have to pick the data of the student like id , name , class , age & address using netbeans jframe then i have to store these data into my package so

java -netbeans help - Java Beginners
java -netbeans help a simple program in netbeans ide to add two... in input.java file ouput is executed and it has print stmt in the cluster.java file... the textarea created in the input.java file..pls how to do this.. if u have ur

jdbc and swing problem in netbeans
jdbc and swing problem in netbeans i reteived the table from database in a jdbc program. next i want to do is place the table as it is in a jpanel.. i am using netbeans IDE can u tel me how to do that one?? urgent

how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible

How to launch my web application from my desktop without opening Netbeans IDE everytime i run the application?
How to launch my web application from my desktop without opening Netbeans IDE... to open Netbeans IDE then need to start Glassfish server,then type the url, so i... for my previous question but i knw how to create JSP pages, I have completed my

how to send the content of jtextarea from netbeans IDE to webpage's textarea in java
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java Hi, i m interested to send the content of my jtextarea which i have developed in netbeans IDE to the webpage's textarea. how can i do

How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide? how to develop, compile & run a rmi program in netbeans 6.9.1 ide? will you please give me a step by step (practical) explaination? Thanks in advance

JPA Examples in NetBeans
; In this section we will show how you can use NetBeans IDE to run JPA applications. NetBeans IDE provides industry standard features... at the end of this tutorial. You can easily import the project in NetBeans IDE

NetBeans
NetBeans why Netbeans IDE is not commonly used Today by most of the companies

Designing of textfield arrays in Netbeans IDE - Swing AWT
in NetBeans IDE.... How can i do this.........???? I have a code which... in NetBeans IDE form designing.... public javax.swing.JTextField...Designing of textfield arrays in Netbeans IDE Respected sir

Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... implementations for most of the methods in the TableModel interface. Using

import geoserver maps in J2ME usin IDE netbeans
import geoserver maps in J2ME usin IDE netbeans i want to see my geoserver maps in J2ME midelt using netbeans.if any one can help me in this regard. Thanks

unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help import... { Hashtable ht=null; UploadFile file=null; try

Hi - IDE Questions
Hi Hi sir,i am using netbeans ide,if i am create a file in netbeans ide,to run that file,we r completely run the project or only run the particular file,is there any option to run only the particular file

JSF Hello World
World example application in NetBeans IDE. This example illustrates how to print hello world in JSF application using NetBeans IDE. NetBeans IDE provides... page in NetBeans IDE Now it will open a jsp page where you can write your code

java IDE's - IDE Questions
java IDE's Hi, deepak what is meant by and IDE? what is the main purpose of using IDE's in JAVA? What is the Difference betweeen NETBEANS and MYECLIPSE? and which one has to prefer more , imean has to be used

JTable populate with resultset.
JTable populate with resultset. How to diplay data of resultset using JTable? JTable is component of java swing toolkit. JTable class is helpful in displaying data in tabular format. You can also edit data. JTable

NET BEANS - IDE Questions
sending a link where you can see how to create a visual-jsf application using netbeans ide http://www.roseindia.net/jsf/visual-jsf.shtml Here, a anothere link where u can see how to create simple jsf application in netbeans ide

netbeans
netbeans guysss m nt able to opemn ma netbeans ide.. no error msg s coming... wn i installed yesterday one msg came stating about some run time error... sm one plzzzzzz hlp me

java swing (jtable)
java swing (jtable) hii..how to get values of a particular record in jtable from ms access database using java swing in netbeans..?? please help... from database and display it in jtable. import java.awt.*; import java.sql.

java swing in netbeans
java swing in netbeans how can create sub menu in java swing using netbeans? Hi Friend, Try the following code: import javax.swing.... fileMenu = new JMenu("File"); menuBar.add(fileMenu); JMenu newmenu

ABOUT Jtable
ABOUT Jtable My Project is Exsice Management in java swing Desktop Application. I M Use Netbeans & Mysql . How can retrive Data in Jtable from Mysql Database in Net Beans

JTable
JTable i want to delete record from JTable using a MenuItem DELETE. and values of JTable are fetched from database....please reply soon

JTable
JTable how to select a definite cell which containing a similar text containg to the one which the user entering from a jtable at runtime in java

how to create a header in jtable using java swing
how to create a header in jtable using java swing how to create a header in jtable using java swing d

Java using Netbeans Object Oriented Programming
Java using Netbeans Object Oriented Programming I am trying to make... numerical order. It then initiates the public method in the second class to print...- ", studentFirst_Name, studentLast_Name); //asks user how many grades short numOfGrades

Latest
Frameworks
Category