Home Answers Viewqa Swing-AWT how to read text file in jtable in netbeans7.0

 
 


Raghav Purankar
how to read text file in jtable in netbeans7.0
0 Answer(s)      a year and 11 months ago
Posted in : Swing AWT

text file is:

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

i want to displaythe above .txt file in jtable as following format having 3 columns

contigID length size

and then display sequence like "ATGCGSA..." in text area which is design below table in netbeans IDE. how to do that ? pls help me thankx

View Answers









Related Pages:
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
Read text File
Read text File  Hi,How can I get line and keep in a String in Java
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set... with AbstractTableModel to inherit its methods and properties. Now we have read the file
JTable
JTable   how to select a definite cell which containing a similar text containg to the one which the user entering from a jtable at runtime in java
How to read text file in Servlets
How to read text file in Servlets       This section illustrates you how to read text file in servlets. In this example we will use the input stream to read the text
how to write and read text for javaME
how to write and read text for javaME  Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
Read Text file from Javascript - JSP-Servlet
Read Text file from Javascript  plz send the code How to Retrieve the data from .txt file thru Javascript? And how to find the perticular words in that file
How to read text file to two different name array
How to read text file to two different name array   I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array
How to read text file to two different name array   I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
read text file and store the data in mysql - JDBC
read text file and store the data in mysql  when we store the data in mysql table from text file its store the data from new line to new column. how to store the data in different column from a single line of text file
How to read the data in text file seperated by by ',' in java using IO Operations
How to read the data in text file seperated by by ',' in java using IO Operations  in Text file data like raju 45,56,67 ramu 46,65,78 raji 34,23,56 this is the student marks in text file.this data read and calculate
How to read a large text file line by line in java?
How to read a large text file line by line in java?  I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
how to read this xml file - XML
how to read this xml file  i want to read this xml file using java... read i have tried lot more , but i am not able to read this xml file... name=client menu=client action=read user employee add
Read from file java
Read from file java  How to Read from file java? What is the best method for a text file having a size of 10GB. Since i have to process the file one line at a time so tell me the very best method. Thank you
Remove JTable row that read txt file records
Remove JTable row that read txt file records  Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
How to read file in java
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
Read Lines from text file
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file  Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
How to read and compare content of two different text file
Description: In the given example you will see how a two text file's content are compared. The BufferedReader class allow us to read a file. The readLine() method used to read the contents of the specified file.  The way
How To Read File In Java with BufferedReader
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... java.io.*; /** * How To Read File In Java with BufferedReader class
How to read the .doc/ .docx file in Java Program
How to read the .doc/ .docx file in Java Program  Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
How to Read a file line by line using BufferedReader?
How to Read a file line by line using BufferedReader?  Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
Read Specific Line from file Using Java
Read Specific Line from file Using Java Here we are going to read a specific line from the text file. For this we have created a for loop to read lines 1 to 10 from the text file. If the loop reached fifth line, the br.readLine() method
Setting an Icon with Text in a Column Head of JTable
Setting an Icon with Text in a Column Head of JTable       In this section, you will learn how to set an icon with text in a column head of JTable component. But what
jtable problem
jtable problem  how to make a cell text hypertext
Java swing: Export excel sheet data to JTable
how to read data from excel file and export it to JTable. In swing applications, sometimes, it is required to display the excel file data into the jtable... of the excel and file. Here is the excel file to be read. Example import
J2ME Read File
J2ME Read File       In this J2ME application, we are going to read the specified file. This example shows you how to read the data of the specified file. To implement this type
How to read and retrieve jtable row values into jtextfield on clicking at particular row ...
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
Java file read write operation
Java file read write operation  how to read and write the data from text file.Suppose i have text file with 4 fields name ,roll no ,marks1,marks2 with more than 20 records......i need to store these value in object and pass
How to read big file line by line in java?
Learn how to write a program in java for reading big text file line by line In this tutorial I will explain you how you can read big file line by line... to read the big file in your java program. For example you have to process some
Read Write
Read Write  Hi; How can I read certain line of say 10 text files and write to one text file   Java Read Multiple Files and store the data into another text file The given code reads all the text files of the directory
Java read file line by line
Java read file line by line In this section, you will learn how to read a file... are going to read a file line by line. For reading text from a file it's better... class is used to read text from a file line by line using it's readLine method
Write Text into File
Write Text into File      ... "write.txt". We are using FileWriter class to read file... to write text into file. At last close output file using close() method
Shading Columns in JTable
Shading Columns in JTable       Earlier you have read about the shading of  the rows in JTable. So, you are now capable for setting the shading the column
jtable
jtable  how to get the values from database into jtable and also add a checkbox into it and then when selected the checkbox it should again insert into database the selected chewckbox.plzz help
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame.  import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How to format text file? - Java Beginners
How to format text file?  I want the answer for following Query ***(Java code) How to open,read and format text file(notepad) or MS-word.../example/java/io/java-read-file-line-by-line.shtml Thanks
Reading Text file and storing in map
Reading Text file and storing in map  Hi I have multiple text files. I want to read thoses files and store those records in map. Map... how it can be done
JTable
JTable  Hi I have problems in setting values to a cell in Jtable which is in a jFrame which implements TableModelListener which has a abstract.... And i'm not able to set value to a particular column. How can i do it? Please
how to update the text file?
how to update the text file?  if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
java read file
java read file  Hello i need some help... i want to read an MS Excel file in java so how to read that file
Read file in java
Read file in java  Hi, How to Read file in java? Thanks   Hi, Read complete tutorial with example at Read file in java. Thanks
CONVERT JTable DATA TO PDF FILE
CONVERT JTable DATA TO PDF FILE  HOW TO CONVERT JTable DATA TO .PDF FILE??PLEASE GIVE ME CODE FOR THAT.   Here is an example that reads the jtable data from the jframe and stored the data into the pdf file in the form
how to update the text file?
how to update the text file?  my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...]; for(int i=0;i File file ; FileReader fr=null ; FileWriter
How to read text from - Java Beginners
How to read text from   How to retrieve text from the images... Does we have any function to get text over the images  Hi Friend, We are providing you a code that will set text over an image using javascript
Read and write file
Read and write file  HI, How to read and write file from Java program? Thanks   Hi, See the following tutorials: Java Write To File Read File Thanks
How to Read a File in Java
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
Java Read File Line by Line - Java Tutorial
Tutorial you will learn how to write java program to read file line by line. We will use the DataInputStream class to Read text File Line by Line. Class... program to Read text File Line by Line
How to read text file in Servlets
this code as a .jsp file named "welcome_to_database_query.jsp"

Ask Questions?

If you are facing any programming issue, such as compilation errors or not able to find the code you are looking for.

Ask your questions, our development team will try to give answers to your questions.