Latest Tutorials| Questions and Answers|Ask Questions?|Site Map



Home Answers Viewqa Java-Beginners how to sort the text file and display it in jtable
Login         

View Questions and Answers by Category

Advertisements


 
Have Programming Question? Ask it here!
 
 
 


Raghav Purankar
how to sort the text file and display it in jtable
0 Answer(s)      3 years and 9 months ago
Posted in : Java Beginners


my text file is:

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans .

pls suggest the logic to print such scenario thanks.


Advertisement
View Answers

Related Tutorials/Questions & Answers:
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file... ctgaggactcctcg i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
Advertisements
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set...); } }  Through the above code, you can insert the file data into JTable
how to update the text file?
how to update the text file?  my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...; } return quantity; }public void display() { System.out.println(item
how to update the text file?
how to update the text file?  if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
How to collect Java input field value display into Jtable?
How to collect Java input field value display into Jtable?  <p>We would like to know how to collection input field data into Jtable...;text rate - input interest rate</li> <li>text Result - Display
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame.  import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How To Display MS Access Table into Swing JTable - Java Beginners
How To Display MS Access Table into Swing JTable  How to Display Records From MS Access Database To JTable. Plz Help Me  Hi Friend...){ System.out.println(e); } JTable table = new JTable(data, columnNames); TableColumn
How to display a file for 24 hours?
How to display a file for 24 hours?  How to display a file for 24 hours
how to sort multiple key columns in CSV file - Java Beginners
how to sort multiple key columns in CSV file  Hi Any one can assist how to sort the multiple key columns in CSV file? Any example will be appreciated. Thanks
how to display webservice response in a text box
how to display webservice response in a text box  Hallo, i have created a webservice and when i sended request to my webservice its sending proper response . the point is how to dispaly the response values in a text box usinj
how to display pdf file on browser
how to display pdf file on browser   In my project i have created one pdf file(by pdfwriter) into my local mechine . after that it need to display in browser as a pdf file . but in jsp i can't display by iframe tag can anyone
how to convert image file to text file?
how to convert image file to text file?  hi, can anybody tell how to convert image file to text file? plz help me
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
Not able to display jtable at runtime
Not able to display jtable at runtime  Hello, can anyone please help...[][] taskcells; JTable ttable; public void BuildTable() { Statement st; ResultSet rs...=new JTable(tasktable); TableColumnModel columnModel
How to append text to an existing file in Java
How to append text to an existing file in Java  How to append text to an existing file in Java
Sort file data and write into another file
Sort file data and write into another file By sorting, you can arrange the data into meaningful order and analyze it more effectively. Here we have one file... and grade. The data is not properly arranged in the file. Now, we have to display
How to read text file in Servlets
How to read text file in Servlets       This section illustrates you how to read text...). Then the writer.println(text) is used to display the content of the file Here
How To Display both image and data into Swing JTable which is retrieved from ms access database
How To Display both image and data into Swing JTable which is retrieved from ms access database  So far this is my code how can i display both image and data from database.. while (rs.next()) { Vector row = new Vector(columns
how can i display a pdf file in a jtextarea
how can i display a pdf file in a jtextarea  I need to display a pdf file in a jtextfield or in a jtextarea.Atlest i need to displat it in a jframe.I have a button and while clicking on it ,i need to choose the pdf file and need
how to display image and text in single jsp page from the mysql database
how to display image and text in single jsp page from the mysql database  hello please help me to display the image and text in single jsp page from mysql database if have any reference code please send me Thanks in advance
How to Display jrxml file on JSP page???
How to Display jrxml file on JSP page???  I made jrxml file using jasper report but how to display on jsp page?? i tried lot but still i didnt find out solution.so pls help me as soon as possible
How to write file text In New Line
How to write file text In New Line  Hi friends, How to write file text in new line in Java program. How to write the syntax for this with example... you went new text in new line. For this we created a new text file named
Display both image and data into Swing JTable
Display both image and data into Swing JTable  How To Display both image and data into Swing JTable which is retrieved from MySQL database
How to Convert Text Files into Gzip File
How to Convert Text Files into Gzip File  Hi, I am developing a small application using PHP language. The real problem is that how do i convert the text files into gzip file. how can i solve the problem.... Tnanks
How to add JTable in JPanel
How to add JTable in JPanel  How to add JTable in JPanel
all sequences to create jdbc and how can i use jtable to display a single columns or multiple columns
all sequences to create jdbc and how can i use jtable to display a single... a view in my database schema so how can i create a jtable to look the view result... ); } } catch(Exception e){} JTable table = new JTable(data, columnNames); JScrollPane
how to display data from jsp file into database
how to display data from jsp file into database  this is a jsp file..." contentType="text/html; charset=UTF-8" pageEncoding="UTF-8"%> <%@page...="text" name="uname"></td></tr> <tr><td>First Name
how to display the output of the newly created excel file
how to display the output of the newly created excel file  the following program will create the test.xlsx file, how can i display the content of the test.xlsx file in the web browser? thanks, %@ page import
How to format text file? - Java Beginners
How to format text file?  I want the answer for following Query ***(Java code) How to open,read and format text file(notepad) or MS-word... String getContents(File aFile) { StringBuilder contents = new StringBuilder
 

 

 

DMCA.com