how to sort the text file and display it in jtable

Home Answers Viewqa Java-Beginners how to sort the text file and display it in jtable

Raghav Purankar

how to sort the text file and display it in jtable
0 Answer(s) a year and 11 months ago
Posted in : Java Beginners

my text file is:

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans .

pls suggest the logic to print such scenario thanks.

View Answers

how to sort the text file and display it in jtable
how to sort the text file and display it in jtable my text file... ctgaggactcctcg i want to display the lines started with ">" symbol to be displayed in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest

how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0 text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text

JTable
JTable how to select a definite cell which containing a similar text containg to the one which the user entering from a jtable at runtime in java

Sort
all the votes have been counted, the program should output a table showing how... ); { System.out.println("Error reading from file

Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set...); } } Through the above code, you can insert the file data into JTable

Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken

how to update the text file?
how to update the text file? my textfile with name list.txt: Rice... in my text file, if the item i entered matches with item in text file.how can i...; } return quantity; }public void display() { System.out.println(item

How to collect Java input field value display into Jtable?
How to collect Java input field value display into Jtable? We would like to know how to collection input field data into Jtable with the following... rate - input interest rate text Result - Display result into Jtable Jtable

Sort file data and write into another file
Sort file data and write into another file By sorting, you can arrange the data into meaningful order and analyze it more effectively. Here we have one file... and grade. The data is not properly arranged in the file. Now, we have to display

Not able to display jtable at runtime
Not able to display jtable at runtime Hello, can anyone please help...[][] taskcells; JTable ttable; public void BuildTable() { Statement st; ResultSet rs...=new JTable(tasktable); TableColumnModel columnModel

Setting an Icon with Text in a Column Head of JTable
Setting an Icon with Text in a Column Head of JTable In this section, you will learn how to set an icon with text in a column head of JTable component. But what

jtable problem
jtable problem how to make a cell text hypertext

JTable
JTable Hello, i cannot display data from my table in the database to the cells of my JTable. please help me

How to read text file in Servlets
How to read text file in Servlets This section illustrates you how to read text...). Then the writer.println(text) is used to display the content of the file Here

Struts2.2.1 sort Tag Example
. The following Example will shows how to implement the sort tag in the Struts2.2.1...;text/html; charset=UTF-8"> <title>Example Sort...Struts2.2.1 sort Tag Example The sort tag is used to sort a List using

Add XML to JTable
Add XML to JTable In this section, you will learn how to access the contents or data of xml document and display its information into the jtable. Java... all the xml file data into the JTable . Here is the person.xml file

Shading Columns in JTable
Shading Columns in JTable ...; the rows in JTable. So, you are now capable for setting the shading the column in JTable. In JTable component the shading columns are the simplest way

jtable
jtable how to get the values from database into jtable and also add a checkbox into it and then when selected the checkbox it should again insert into database the selected chewckbox.plzz help

how to display data from jsp file into database
how to display data from jsp file into database this is a jsp file..." contentType="text/html; charset=UTF-8" pageEncoding="UTF-8"%> <%@page...="text" name="uname"></td></tr> <tr><td>First Name

Java search text file
Java search text file In this tutorial, you will learn how to search a text... the name of a text file to search for. If the name does not have a .txt extension, display an error message. Then search the file in the current directory

JTable
JTable Hi I have problems in setting values to a cell in Jtable which is in a jFrame which implements TableModelListener which has a abstract.... And i'm not able to set value to a particular column. How can i do it? Please

how to update the text file?
how to update the text file? if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please

how to display data from mysql table in text box using jsp??
how to display data from mysql table in text box using jsp?? <p>hi, i have a written a code to display data from a mysql table into txtboxes... at line: 113 in the jsp file: /Cat1.jsp The local variable v_RGPC may not have

CONVERT JTable DATA TO PDF FILE
CONVERT JTable DATA TO PDF FILE HOW TO CONVERT JTable DATA TO .PDF FILE??PLEASE GIVE ME CODE FOR THAT. Here is an example that reads the jtable data from the jframe and stored the data into the pdf file in the form

How To Display MS Access Table into Swing JTable - Java Beginners
How To Display MS Access Table into Swing JTable How to Display Records From MS Access Database To JTable. Plz Help Me Hi Friend...){ System.out.println(e); } JTable table = new JTable(data, columnNames); TableColumn

Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame. import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane

Multi-line cells in the JTable - Java Tutorials
, asked me how to display a JTextArea within a cell of a JTable. I sensed it would...Multi-line cells in the JTable 2002-04-11 The Java Specialists' Newsletter [Issue 045] - Multi-line cells in the JTable Author: Dr. Heinz M. Kabutz

Display non-duplicate words from file
Display non-duplicate words from file In this tutorial, you will learn how to read a text file and display non-duplicate words in ascending order. The given code reads the file and stored the file text into StringBuffer. The buffer

how to sort multiple key columns in CSV file - Java Beginners
how to sort multiple key columns in CSV file Hi Any one can assist how to sort the multiple key columns in CSV file? Any example will be appreciated. Thanks

how to display webservice response in a text box
how to display webservice response in a text box Hallo, i have created a webservice and when i sended request to my webservice its sending proper response . the point is how to dispaly the response values in a text box usinj

Java JTable
Java JTable I am create one application. The application is same as MSExcel. but the content do not modify by others. I am refer the following link. link text That work fine. But i want display content in my datatbase. If i

how to display pdf file on browser
how to display pdf file on browser In my project i have created one pdf file(by pdfwriter) into my local mechine . after that it need to display in browser as a pdf file . but in jsp i can't display by iframe tag can anyone

Java swing: Export excel sheet data to JTable
how to read data from excel file and export it to JTable. In swing applications, sometimes, it is required to display the excel file data into the jtable... and display its content to jtable. In the given code, we have used getWorkbook

Setting Tool Tips on Cells in a JTable
): This is the method that is used to display the text in tool tips... Setting Tool Tips on Cells in a JTable This section tells you, how to set

Sort last modified file time in java
Sort last modified file time in java How to sort the last modified file time in java? import java.io.*; import java.util.*; import...[] args) throws IOException { File file = new File("C:/file.txt

how to convert image file to text file?
how to convert image file to text file? hi, can anybody tell how to convert image file to text file? plz help me

Help With Costructing Selection sort?
Help With Costructing Selection sort? Using a selection sort, for each entry in the array, display the original index of the first dimension... figure out just dont know how to incorporate the above question. Thanks

Fancy Box plug-in for text, portal & swf file
Fancy Box plug-in for text, portal & swf file In this section, you will learn how to display text, portal & swf file inside fancy box by clicking... click on any link like text, portal & swf file, the output will be open

How to use JTable with MS-Access
How to use JTable with MS-Access I have Three Column in Database... this data in JTable. How can I do it. I also want to EDIT and DELETE this Data... and display it in JTable. import java.awt.*; import java.sql.*; import java.util.

Java Dictionary-Sort,Extract
language) dictionary by collecting english/other language words in a text file;then using that text file I need to sort the words collected in alphabetical order using some hashing or other technique in another text file without occurring

Sorting text file
local website. i'm storing all file list in text file. And also adding a value to each line at the beginning. now i want to sort file content in descending order according to begin value. Text File having list like this: 5| 3| can anyone

how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea

How display a image on servlet from file upload - JSP-Servlet
How display a image on servlet from file upload Dear Sir, My issue is: How display a image on servlet from file upload I receive your answer today...) throws ServletException, IOException{ response.setContentType("text/html

jtable query compare with date
jtable query compare with date how to transfer daytable data... in which i have to display database records in jtable .now I want to transfer particular data which month is over to another jtable. plz sir give me the code

How to delete and update from Jtable cell in swing app
How to delete and update from Jtable cell in swing app Hii Sir, I am developing a swing app for adding,updating and deleting from jtable... is getting removed from the jtable but selected row is getting deleted from

How display a Image on servlet from file upload - JSP-Servlet
How display a Image on servlet from file upload Dear Sir, I were ask a question that How display the Image on servlet through file upload. Today I get your answer. But Sir, It code not display the image on servlet

Simple Text display
Simple Text display In this tutorial we will come to know that how to display any text in a text input box using a button click. It is very simple

Ask Questions?

If you are facing any programming issue, such as compilation errors or not able to find the code you are looking for.

Ask your questions, our development team will try to give answers to your questions.

Tutorial Topics